You are viewing the site in preview mode

Skip to main content

Table 3 Novel variants in HG002 genome, missing in v3.3.2 benchmark variant, discovered by Sanger sequencing together with the prediction information by NanoCaller and other variant callers using ONT reads basecall with Guppy 2.3.4. NanoCaller model used was trained on ONT HG001 Guppy 2.3.8 basecalled reads

From: NanoCaller for accurate detection of SNPs and indels in difficult-to-map regions from long-read sequencing by haplotype-aware deep neural networks

Chrom Position REF ALT Genotype Nanocaller Medaka Clair Longshot
chr1 78883942 C T 1|0 Correct
chr1 78883952 ATATATATTTATCCTTTATATATATATTCTT A 1|0
chr2 227913871 A ATATCTATCTATC 1|0 Correct Correct Correct
chr2 227913885 G A 1|0 Correct Correct Correct Correct
chr2 227913889 G A 1|0 Correct Correct Correct Correct
chr2 227913928 T TA 1|0 Wrong allele Correct
chr2 227913931 A T 1|0 Correct
chr3 5336450 A T,C 1|2 Correct Wrong allele Wrong allele Wrong allele
chr3 5336452 C CGCGT 0|1
chr3 5336465 ACACACACACACG A 0|1 Wrong variant type Wrong allele
chr3 5336477 GCA G 1|0 Wrong allele Correct Wrong allele
chr3 5336487 A G 0|1 Wrong variant type Wrong variant type
chr6 160009985 C CTTAA 0|1 Wrong allele Wrong allele
chr6 160009986 C A 0|1 Wrong zygosity Wrong allele Wrong variant type Wrong allele and zygosity
chr6 167130970 G GGGCCCCCCTCCCTCCGGGACTCCTCCCTCT 0|1
chr6 167130972 GA G 1|0 Wrong zygosity Wrong zygosity
chr6 167130973 A G 0|1
chr6 167130976 A C 1|1 Correct Wrong zygosity Correct Correct
chr6 167130986 T C 1|0 Correct Wrong allele Wrong allele
chr6 167130989 A G 1|1 Correct Correct Correct Correct
chr6 167130990 C A 1|0
chr6 167130992 C T 1|0 Correct Correct Correct
chr9 134784949 C T 0|1 Correct Correct Correct Correct
chr9 134784951 G T 0|1
chr9 134784955 G GGGGGGCA 0|1
chr9 134784956 T G 0|1 Correct Wrong variant type Wrong variant type
chr9 135663795 ACAGAGGGGGACCTGGAGGGGCAGAGGAGAGACCTGTGGGG A 0|1
chr9 135663892 A G 1|1 Wrong zygosity Correct Correct Correct
chr9 135663893 T A,G 1|2 Correct Wrong allele Wrong allele Wrong allele
chr11 113466435 G GC 1|1 Correct Correct
chr11 113466437 A T 1|1 Correct Wrong allele Wrong allele Wrong allele
chr12 100940063 A AT 0|1 Correct
chr12 100940065 G C 0|1 Correct Wrong allele
chr14 75318035 C T 1|0 Correct Correct Correct Correct
chr14 75318038 AT A 1|0 Wrong allele Correct
chr14 75318052 T C 1|0 Correct
chr14 75318054 T G 1|0
chr20 11064571 T TGA 0|1 Wrong allele
chr20 11064574 A ATTTTCAAGACTATTGTGACTATGAC 0|1 Correct
chr20 11064578 A T 0|1 Correct
chr20 11064579 C T 0|1 Correct Correct Wrong variant type